content stringlengths 35 416k | sha1 stringlengths 40 40 | id int64 0 710k |
|---|---|---|
def is_mongo_configured(accessor):
"""
works out if mongodb is configured to run with trackerdash
i.e. first time running
"""
return accessor.verify_essential_collections_present() | c0487f6d899e6cee4f6bbb31bffbd17890812c30 | 3,946 |
import ast
def maybe_get_docstring(node: ast.AST):
"""Get docstring from a constant expression, or return None."""
if (
isinstance(node, ast.Expr)
and isinstance(node.value, ast.Constant)
and isinstance(node.value.value, str)
):
return node.value.value
elif (
is... | 23171c739f3c9ae6d62ecf3307ac7c3409852d6b | 3,947 |
def _find(xs, predicate):
"""Locate an item in a list based on a predicate function.
Args:
xs (list) : List of data
predicate (function) : Function taking a data item and returning bool
Returns:
(object|None) : The first list item that predicate returns True for or None
"""
... | 94d8dd47e54e1887f67c5f5354d05dc0c294ae52 | 3,949 |
def version_for(plugin):
# (Plugin) -> Optional[str]
"""Determine the version of a plugin by its module.
:param plugin:
The loaded plugin
:type plugin:
Plugin
:returns:
version string for the module
:rtype:
str
"""
module_name = plugin.plugin.__module__
... | 6d7c4ccc868d11d28c92d1264d52488e22d7f5e5 | 3,952 |
def _extract_action_num_and_node_id(m):
"""Helper method: Extract *action_num* and *node_id* from the given regex
match. Convert *action_num* to a 0-indexed integer."""
return dict(
action_num=(int(m.group('action_num')) - 1),
node_id=m.group('node_id'),
) | f1e5f0b81d6d82856b7c00d67270048e0e4caf38 | 3,953 |
import re
def get_uid_cidx(img_name):
"""
:param img_name: format output_path / f'{uid} cam{cidx} rgb.png'
"""
img_name = img_name.split("/")[-1]
assert img_name[-8:] == " rgb.png"
img_name = img_name[:-8]
m = re.search(r'\d+$', img_name)
assert not m is None
cidx = int(m.group())... | 29363f4fc686fa972c2249e5e1db1a333625be36 | 3,954 |
import os
def file_get_size_in_bytes(path: str) -> int:
"""Return the size of the file in bytes."""
return int(os.stat(path).st_size) | e9692259d2f5cb8f536cb8c6a0ae53e0b7c6efd1 | 3,958 |
def git2pep440(ver_str):
"""
Converts a git description to a PEP440 conforming string
:param ver_str: git version description
:return: PEP440 version description
"""
dash_count = ver_str.count('-')
if dash_count == 0:
return ver_str
elif dash_count == 1:
return ver_str.s... | 7c4a5185305627c22118722b73b2facfa830875a | 3,959 |
import math
def iucr_string(values):
"""Convert a central value (average) and its s.u. into an IUCr compliant number representation.
:param values: pair of central value (average) and s.u.
:type values: tuple((float, float))
:return: IUCr compliant representation
:rtype: str
"""
if values... | c6c6602aa0ba481ed5467ed62df59a16f26a8091 | 3,960 |
def sse_pack(d):
"""For sending sse to client. Formats a dictionary into correct form for SSE"""
buf = ''
for k in ['retry','id','event','data']:
if k in d.keys():
buf += '{}: {}\n'.format(k, d[k])
return buf + '\n' | a497c7ab919115d59d49f25abfdb9d88b0963af3 | 3,961 |
def filter_dictionary(dictionary, filter_func):
"""
returns the first element of `dictionary` where the element's key pass the filter_func.
filter_func can be either a callable or a value.
- if callable filtering is checked with `test(element_value)`
- if value filtering is checked ... | f5fa77a51241323845eb9a59adc9df7f662f287b | 3,964 |
def spike_lmax(S, Q):
"""Maximum spike given a perturbation"""
S2 = S * S
return ((1.0 / Q) + S2) * (1 + (1.0 / S2)) | ba845e3255e4d3eb5116d279a209f4424062603b | 3,965 |
def _get_urls():
"""Stores the URLs for histology file downloads.
Returns
-------
dict
Dictionary with template names as keys and urls to the files as values.
"""
return {
"fsaverage": "https://box.bic.mni.mcgill.ca/s/znBp7Emls0mMW1a/download",
"fsaverage5": "https://box... | 697cf29b3caaeda079014fd342fbe7ad4c650d30 | 3,966 |
import struct
def guid_bytes_to_string(stream):
"""
Read a byte stream to parse as GUID
:ivar bytes stream: GUID in raw mode
:returns: GUID as a string
:rtype: str
"""
Data1 = struct.unpack("<I", stream[0:4])[0]
Data2 = struct.unpack("<H", stream[4:6])[0]
Data3 = struct.unpack("<H"... | 23f013b48806d1d2d4b4bec4ab4a5fcf6fc2e6b0 | 3,967 |
from typing import List
def two_loops(N: List[int]) -> List[int]:
"""Semi-dynamic programming approach using O(2n):
- Calculate the product of all items before item i
- Calculate the product of all items after item i
- For each item i, multiply the products for before and after i
L[i] = N[i-1] *... | 3620aa19833b2e967b2c295fa53ba39bf3b6b70d | 3,968 |
def rgb_to_hex(r, g, b):
"""Turn an RGB float tuple into a hex code.
Args:
r (float): R value
g (float): G value
b (float): B value
Returns:
str: A hex code (no #)
"""
r_int = round((r + 1.0) / 2 * 255)
g_int = round((g + 1.0) / 2 * 255)
b_int = round((b + 1... | a5181c475c798bbd03020d81da10d8fbf86cc396 | 3,969 |
def odd(x):
"""True if x is odd."""
return (x & 1) | 9cd383ea01e0fed56f6df42648306cf2415f89e9 | 3,971 |
import glob
import os
def get_file_paths_by_pattern(pattern='*', folder=None):
"""Get a file path list matched given pattern.
Args:
pattern(str): a pattern to match files.
folder(str): searching folder.
Returns
(list of str): a list of matching paths.
Examples
>>> ge... | 467485dd4b162654bd73cf412c93558fa43a5b8e | 3,972 |
import re
def remove_conjunction(conjunction: str, utterance: str) -> str:
"""Remove the specified conjunction from the utterance.
For example, remove the " and" left behind from extracting "1 hour" and "30 minutes"
from "for 1 hour and 30 minutes". Leaving it behind can confuse other intent
parsing... | 67313565c7da2eadc4411854d6ee6cb467ee7159 | 3,973 |
def othertitles(hit):
"""Split a hit.Hit_def that contains multiple titles up, splitting out the hit ids from the titles."""
id_titles = hit.Hit_def.text.split('>')
titles = []
for t in id_titles[1:]:
fullid, title = t.split(' ', 1)
hitid, id = fullid.split('|', 2)[1:3]
titles.a... | fa5bbb47d26adbc61817e78e950e81cc05eca4a6 | 3,974 |
from typing import List
def read_plaintext_inputs(path: str) -> List[str]:
"""Read input texts from a plain text file where each line corresponds to one input"""
with open(path, 'r', encoding='utf8') as fh:
inputs = fh.read().splitlines()
print(f"Done loading {len(inputs)} inputs from file '{path}... | 27b00f4dfcdf4d76e04f08b6e74c062f2f7374d0 | 3,975 |
def distance_constraints_too_complex(wordConstraints):
"""
Decide if the constraints on the distances between pairs
of search terms are too complex, i. e. if there is no single word
that all pairs include. If the constraints are too complex
and the "distance requirements are strict" flag is set,
... | 43429fd64dbf5fa118e2cbf1e381686e1a8518c9 | 3,976 |
def _file_path(ctx, val):
"""Return the path of the given file object.
Args:
ctx: The context.
val: The file object.
"""
return val.path | 7c930f2511a0950e29ffc327e85cf9b2b3077c02 | 3,977 |
def Mapping_Third(Writelines, ThirdClassDict):
"""
:param Writelines: 将要写入的apk的method
:param ThirdClassDict: 每一个APK对应的第三方的字典
:return: UpDateWritelines
"""
UpDateWriteLines = []
for l in Writelines:
if l.strip() in list(ThirdClassDict.keys()):
UpDateWriteLines.extend(Thir... | eb94db36d06104007cbbacf8884cf6d45fee46b5 | 3,978 |
def total_angular_momentum(particles):
"""
Returns the total angular momentum of the particles set.
>>> from amuse.datamodel import Particles
>>> particles = Particles(2)
>>> particles.x = [-1.0, 1.0] | units.m
>>> particles.y = [0.0, 0.0] | units.m
>>> particles.z = [0.0, 0.0] | units.m
... | 8eca23b7b1a8fc8a7722543f9193f0e4a3397f24 | 3,979 |
def find_contiguous_set(target_sum: int, values: list[int]) -> list[int]:
"""Returns set of at least 2 contiguous values that add to target sum."""
i = 0
set_ = []
sum_ = 0
while sum_ <= target_sum:
sum_ += values[i]
set_.append(values[i])
if sum_ == target_sum and len(set... | 64b6c1f99946856a33a79fed3d43395a5a9c1000 | 3,981 |
def move_character(character: dict, direction_index=None, available_directions=None) -> tuple:
"""
Change character's coordinates.
:param character: a dictionary
:param direction_index: a non-negative integer, optional
:param available_directions: a list of strings, optional
:precondition: char... | cc5cc3115437d0dc4e9b7ba7845565ee8147be30 | 3,982 |
def scrap_insta_description(inst) -> str:
"""
Scrap description from instagram account HTML.
"""
description = inst.body.div.section.main.div.header.section.find_all(
'div')[4].span.get_text()
return description | 898fa0d1cb44606374b131b8b471178a22ab74ed | 3,983 |
import six
import os
def file_size(f):
"""
Returns size of file in bytes.
"""
if isinstance(f, (six.string_types, six.text_type)):
return os.path.getsize(f)
else:
cur = f.tell()
f.seek(0, 2)
size = f.tell()
f.seek(cur)
return size | f999382958a972abbcf593c02e8e8e3609d8f44a | 3,984 |
def __get_from_imports(import_tuples):
""" Returns import names and fromlist
import_tuples are specified as
(name, fromlist, ispackage)
"""
from_imports = [(tup[0], tup[1]) for tup in import_tuples
if tup[1] is not None and len(tup[1]) > 0]
return from_imports | 28df8225ad9440386342c38657944cfe7ac3d3ca | 3,985 |
import logging
import os
import sys
def logger():
"""
Setting upp root and zeep logger
:return: root logger object
"""
root_logger = logging.getLogger()
level = logging.getLevelName(os.environ.get('logLevelDefault', 'INFO'))
root_logger.setLevel(level)
stream_handler = logging.StreamH... | b7f3af5555eae953825c42aed18869deafa9f38d | 3,986 |
def some_function(t):
"""Another silly function."""
return t + " python" | 2bd8adc315e97409758f13b0f777ccd17eb4b820 | 3,987 |
import random
import hmac
def hash_password(password, salthex=None, reps=1000):
"""Compute secure (hash, salthex, reps) triplet for password.
The password string is required. The returned salthex and reps
must be saved and reused to hash any comparison password in
order for it to match the ... | cac468818560ed52b415157dde71d5416c34478c | 3,988 |
import argparse
def _parse_args():
"""
Parse arguments for the CLI
"""
parser = argparse.ArgumentParser()
parser.add_argument(
'--fovs',
type=str,
required=True,
help="Path to the fov data",
)
parser.add_argument(
'--exp',
type=str,
... | ecea45baba3c89e3fd81613a256c5be300e01051 | 3,989 |
def calculate_ani(blast_results, fragment_length):
"""
Takes the input of the blast results, and calculates the ANI versus the reference genome
"""
sum_identity = float(0)
number_hits = 0 # Number of hits that passed the criteria
total_aligned_bases = 0 # Total of DNA bases that passed the cri... | 09b649dda337d2b812f5c5fd9ec75b34737e3f15 | 3,992 |
def mixed_social_welfare(game, mix):
"""Returns the social welfare of a mixed strategy profile"""
return game.expected_payoffs(mix).dot(game.num_role_players) | 72c465211bdc79c9fcf2b1b9d8c7dd5abae5d8df | 3,993 |
def init_app(app):
"""init the flask application
:param app:
:return:
"""
return app | 6e460eb1fdc19553c6c4139e60db06daec507a2d | 3,995 |
def _rec_filter_to_info(line):
"""Move a DKFZBias filter to the INFO field, for a record.
"""
parts = line.rstrip().split("\t")
move_filters = {"bSeq": "strand", "bPcr": "damage"}
new_filters = []
bias_info = []
for f in parts[6].split(";"):
if f in move_filters:
bias_inf... | 496056126bdf390a6213dfad5c40c4a14ec35caa | 3,996 |
def classNumber(A):
""" Returns the number of transition classes in the matrix A """
cos = 0
if type(A[0][0]) == list:
cos = len(A)
else:
cos = 1
return cos | a71bce468f7429746bfe246d94f5dcebb85c41d4 | 3,997 |
def fix_CompanySize(r):
"""
Fix the CompanySize column
"""
if type(r.CompanySize) != str:
if r.Employment == "Independent contractor, freelancer, or self-employed":
r.CompanySize = "0 to 1 Employees"
elif r.Employment in [
"Not employed, but looking for work",
... | bd34bb3e72920fb7ef37279a743198387b1c4717 | 3,998 |
def upper_camel_to_lower_camel(upper_camel: str) -> str:
"""convert upper camel case to lower camel case
Example:
CamelCase -> camelCase
:param upper_camel:
:return:
"""
return upper_camel[0].lower() + upper_camel[1:] | e731bbee45f5fc3d8e3e218837ccd36c00eff734 | 3,999 |
def get(isamAppliance, cert_dbase_id, check_mode=False, force=False):
"""
Get details of a certificate database
"""
return isamAppliance.invoke_get("Retrieving all current certificate database names",
"/isam/ssl_certificates/{0}/details".format(cert_dbase_id)) | 34ade7c42fcc1b1409b315f8748105ee99157986 | 4,000 |
import random
def t06_ManyGetPuts(C, pks, crypto, server):
"""Many clients upload many files and their contents are checked."""
clients = [C("c" + str(n)) for n in range(10)]
kvs = [{} for _ in range(10)]
for _ in range(200):
i = random.randint(0, 9)
uuid1 = "%08x" % random.randint(... | 384aa2b03169da613b25d2da60cdd1ec007aeed5 | 4,002 |
import xxhash
def hash_array(kmer):
"""Return a hash of a numpy array."""
return xxhash.xxh32_intdigest(kmer.tobytes()) | 9761316333fdd9f28e74c4f1975adfca1909f54a | 4,004 |
def PyCallable_Check(space, w_obj):
"""Determine if the object o is callable. Return 1 if the object is callable
and 0 otherwise. This function always succeeds."""
return int(space.is_true(space.callable(w_obj))) | e5b8ee9bbbdb0fe53d6fc7241d19f93f7ee8259a | 4,006 |
def idxs_of_duplicates(lst):
""" Returns the indices of duplicate values.
"""
idxs_of = dict({})
dup_idxs = []
for idx, value in enumerate(lst):
idxs_of.setdefault(value, []).append(idx)
for idxs in idxs_of.values():
if len(idxs) > 1:
dup_idxs.extend(idxs)
return ... | adc8a0b0223ac78f0c8a6edd3d60acfaf7ca4c04 | 4,007 |
def aslist(l):
"""Convenience function to wrap single items and lists, and return lists unchanged."""
if isinstance(l, list):
return l
else:
return [l] | 99ccef940229d806d27cb8e429da9c85c44fed07 | 4,008 |
import argparse
def get_args():
"""Parse command line arguments and return namespace object"""
parser = argparse.ArgumentParser(description='Transcode some files')
parser.add_argument('-c', action="store", dest="config", required=True)
parser.add_argument('-l', action="store", dest="limit", type=int, ... | 8d811d1ff9437eef6fe5031618f9561248e40940 | 4,009 |
import os
def _write(info, directory, format, name_format):
"""
Writes the string info
Args:
directory (str): Path to the directory where to write
format (str): Output format
name_format (str): The file name
"""
#pylint: disable=redefined-builtin
file_name = name_forma... | c8f595769607151aa771b4d8d841b4beee77bc9e | 4,010 |
def enough_data(train_data, test_data, verbose=False):
"""Check if train and test sets have any elements."""
if train_data.empty:
if verbose:
print('Empty training data\n')
return False
if test_data.empty:
if verbose:
print('Empty testing data\n')
retu... | f11014d83379a5df84a67ee3b8f1e85b23c058f7 | 4,011 |
def compute_time_overlap(appointment1, appointment2):
"""
Compare two appointments on the same day
"""
assert appointment1.date_ == appointment2.date_
print("Checking for time overlap on \"{}\"...".
format(appointment1.date_))
print("Times to check: {}, {}".
format(appointmen... | c459ef52d78bc8dd094d5be9c9f4f035c4f9fcaa | 4,012 |
import hashlib
def hash64(s):
"""Вычисляет хеш - 8 символов (64 бита)
"""
hex = hashlib.sha1(s.encode("utf-8")).hexdigest()
return "{:x}".format(int(hex, 16) % (10 ** 8)) | e35a367eac938fdb66584b52e1e8da59582fdb9a | 4,014 |
def inc(x):
""" Add one to the current value """
return x + 1 | c8f9a68fee2e8c1a1d66502ae99e42d6034b6b5c | 4,015 |
import os
import hashlib
def hash_file(filename):
"""
computes hash value of file contents, to simplify pytest assert statements for
complex test cases that output files. For cross-platform compatibility, make sure
files are read/written in binary, and use unix-style line endings, otherwise hashes
... | e26f92869a44c0e60fcd58764069b0c7828dee95 | 4,018 |
def predict_to_score(predicts, num_class):
"""
Checked: the last is for 0
===
Example: score=1.2, num_class=3 (for 0-2)
(0.8, 0.2, 0.0) * (1, 2, 0)
:param predicts:
:param num_class:
:return:
"""
scores = 0.
i = 0
while i < num_class:
scores += i * ... | ee4038583404f31bed42bed4eaf6d0c25684c0de | 4,019 |
import time
def offsetTimer():
"""
'Starts' a timer when called, returns a timer function that returns the
time in seconds elapsed since the timer was started
"""
start_time = time.monotonic()
def time_func():
return time.monotonic() - start_time
return time_func | 348105a408ccedd1fcb840b73d5a58dfd59dd8cc | 4,022 |
import os
def _get_sender(pusher_email):
"""Returns "From" address based on env config and default from."""
use_author = 'GITHUB_COMMIT_EMAILER_SEND_FROM_AUTHOR' in os.environ
if use_author:
sender = pusher_email
else:
sender = os.environ.get('GITHUB_COMMIT_EMAILER_SENDER')
return ... | 09167bfd09ff031d60b4ca033fbb0cad206393f9 | 4,023 |
from datetime import datetime
def parse_iso8601(dtstring: str) -> datetime:
"""naive parser for ISO8061 datetime strings,
Parameters
----------
dtstring
the datetime as string in one of two formats:
* ``2017-11-20T07:16:29+0000``
* ``2017-11-20T07:16:29Z``
"""
return... | 415a4f3a9006109e31ea344cf99e885a3fd2738d | 4,026 |
def splinter_session_scoped_browser():
"""Make it test scoped."""
return False | a7587f6edff821bab3052dca73929201e98dcf56 | 4,028 |
def maskStats(wins, last_win, mask, maxLen):
"""
return a three-element list with the first element being the total proportion of the window that is masked,
the second element being a list of masked positions that are relative to the windown start=0 and the window end = window length,
and the third bein... | b5d75d2e86f1b21bf35cbc69d360cd1639c5527b | 4,030 |
import re
def is_youtube_url(url: str) -> bool:
"""Checks if a string is a youtube url
Args:
url (str): youtube url
Returns:
bool: true of false
"""
match = re.match(r"^(https?\:\/\/)?(www\.youtube\.com|youtu\.be)\/.+$", url)
return bool(match) | 97536b8e7267fb5a72c68f242b3f5d6cbd1b9492 | 4,031 |
def time_nanosleep():
""" Delay for a number of seconds and nanoseconds"""
return NotImplementedError() | 9ec91f2ef2656b5a481425dc65dc9f81a07386c2 | 4,032 |
def item_len(item):
"""return length of the string format of item"""
return len(str(item)) | 7d68629a5c2ae664d267844fc90006a7f23df1ba | 4,033 |
def is_numeric(array):
"""Return False if any value in the array or list is not numeric
Note boolean values are taken as numeric"""
for i in array:
try:
float(i)
except ValueError:
return False
else:
return True | 2ab0bb3e6c35e859e54e435671b5525c6392f66c | 4,034 |
import platform
import os
def get_develop_directory():
"""
Return the develop directory
"""
if platform.system() == "Windows":
return os.path.dirname(os.path.realpath(__file__)) + "\\qibullet"
else:
return os.path.dirname(os.path.realpath(__file__)) + "/qibullet" | 5654b3c5b2417e8429a3ec2ca310567a185d78a1 | 4,036 |
def contains_message(response, message):
"""
Inspired by django's self.assertRaisesMessage
Useful for confirming the response contains the provided message,
"""
if len(response.context['messages']) != 1:
return False
full_message = str(list(response.context['messages'])[0])
return... | 4afcdba84603b8b53095a52e769d0a8e3f7bbb17 | 4,037 |
import re
def since(version):
"""A decorator that annotates a function to append the version
of skutil the function was added. This decorator is an adaptation of PySpark's.
Parameters
----------
version : str, float or int
The version the specified method was added to skutil.
Exam... | e6b29b5e4c67ba4a213b183a0b79a1f16a85d81c | 4,038 |
def striptag(tag):
"""
Get the short representation of a fully qualified tag
:param str tag: a (fully qualified or not) XML tag
"""
if tag.startswith('{'):
return tag.rsplit('}')[1]
return tag | f0193e3f792122ba8278e599247439a91139e72b | 4,039 |
def equal(* vals):
"""Returns True if all arguments are equal"""
if len(vals) < 2:
return True
a = vals[0]
for b in vals[1:]:
if a != b:
return False
return True | dbd947016d2b84faaaa7fefa6f35975da0a1b5ec | 4,041 |
def get_command(tool_xml):
"""Get command XML element from supplied XML root."""
root = tool_xml.getroot()
commands = root.findall("command")
command = None
if len(commands) == 1:
command = commands[0]
return command | 8d50b2675b3a6089b15b5380025ca7def9e4339e | 4,043 |
def get_elements(xmldoc, tag_name, attribute):
"""Returns a list of elements"""
l = []
for item in xmldoc.getElementsByTagName(tag_name) :
value = item.getAttribute(attribute)
l.append( repr( value ) )
return l | 2cda65802d0dc1ebbb7796f6a43fa9bacfbe852e | 4,044 |
import os
def get_tests_directory() -> str:
"""
Returns the path of the top level directory for tests.
Returns: The path of the top level directory for tests.
This is useful for constructing paths to the test files.
"""
module_file_path = os.path.abspath(__file__)
return os.path.dirname(m... | 35b445342ea6cf6c6f659118d32b0b8c9724a7e8 | 4,046 |
import re
def ParseTimeCommandResult(command_result):
"""Parse command result and get time elapsed.
Args:
command_result: The result after executing a remote time command.
Returns:
Time taken for the command.
"""
time_data = re.findall(r'real\s+(\d+)m(\d+.\d+)', command_result)
time_in_seconds... | fc92d4b996716ddb2253bf4eb75ed9860c43b2d7 | 4,047 |
def getNumberOfPublicIp():
"""Get the total number of public IP
return: (long) Number of public IP
"""
#No need to calculate this constant everytime
return 3689020672
# Real implementation:
#ranges = getValidPublicIpRange()
#number_of_ip = 0
#for range in ranges:
# number_of_ip = number_of_ip + (r... | 79221376f64d0a44da06746bc28f0bb7db808b0f | 4,048 |
import socket
def check_reverse_lookup():
"""
Check if host fqdn resolves to current host ip
"""
try:
host_name = socket.gethostname().lower()
host_ip = socket.gethostbyname(host_name)
host_fqdn = socket.getfqdn().lower()
fqdn_ip = socket.gethostbyname(host_fqdn)
return host_ip == fqdn_ip
... | 4979ba32d03782258f322ec86b2cd1c24fb4de2c | 4,049 |
def get_grains_connected_to_face(mesh, face_set, node_id_grain_lut):
"""
This function find the grain connected to the face set given as argument.
Three nodes on a grain boundary can all be intersected by one grain
in which case the grain face is on the boundary or by two grains. It
is therefore su... | cb4adff2d6ffe3c32e2a1fc8058e6ad1fed9b2c9 | 4,050 |
def argmin(x):
"""
Returns the index of the smallest element of the iterable `x`.
If two or more elements equal the minimum value, the index of the first
such element is returned.
>>> argmin([1, 3, 2, 0])
3
>>> argmin(abs(x) for x in range(-3, 4))
3
"""
argmin_ = None
min_... | 8d6778182bf3c18ffa6ef72093bf19a818d74911 | 4,051 |
def find_spot(entry, list):
"""
return index of entry in list
"""
for s, spot in enumerate(list):
if entry==spot:
return s
else:
raise ValueError("could not find entry: "+ str(entry)+ " in list: "+ str(list)) | e218822e5e56a62c40f5680751c1360c56f05f4a | 4,052 |
import os
def getPath(path=__file__):
"""
Get standard path from path. It supports ~ as home directory.
:param path: it can be to a folder or file. Default is __file__ or module's path.
If file exists it selects its folder.
:return: dirname (path to a folder)
.. note:: It is the ... | ef1a0997de2febea075b9ce44414c533806f6125 | 4,053 |
def geom_to_tuple(geom):
"""
Takes a lat/long point (or geom) from KCMO style csvs.
Returns (lat, long) tuple
"""
geom = geom[6:]
geom = geom.replace(" ", ", ")
return eval(geom) | 003f25a0ebc8fd372b63453e4782aa52c0ad697c | 4,054 |
import sys
def argumentParser(listOfArguments):
"""Parses arguments"""
argumentParserFilter = {}
for argument in listOfArguments:
if argument in sys.argv:
argumentParserFilter[listOfArguments[argument]] = True
else:
argumentParserFilter[listOfArguments[argument]] ... | 939cfea9c6b4f8deec08b4afb73427183b551ccc | 4,055 |
def get_reg_part(reg_doc):
"""
Depending on source, the CFR part number exists in different places. Fetch
it, wherever it is.
"""
potential_parts = []
potential_parts.extend(
# FR notice
node.attrib['PART'] for node in reg_doc.xpath('//REGTEXT'))
potential_parts.extend(
... | 33f4c2bb9a4e2f404e7ef94a3bfe3707a3b1dd93 | 4,056 |
def my_join(x):
"""
:param x: -> the list desired to join
:return:
"""
return ''.join(x) | bffc33247926c2b1ebe1930700ed0ad9bcb483ec | 4,058 |
def template(spec_fn):
"""
>>> from Redy.Magic.Classic import template
>>> import operator
>>> class Point:
>>> def __init__(self, p):
>>> assert isinstance(p, tuple) and len(p) is 2
>>> self.x, self.y = p
>>> def some_metrics(p: Point):
>>> return p.x + 2 * p... | a8fd64926cdbec73c1a31c20a27174c86af3405e | 4,060 |
def iou_set(set1, set2):
"""Calculate iou_set """
union = set1.union(set2)
return len(set1.intersection(set2)) / len(union) if union else 0 | f0087b640e8b9a87167d7e2b645aca3c565e09c1 | 4,061 |
import time
def time_measured(fkt):
"""
Decorator to measure execution time of a function
It prints out the measured time
Parameters
----------
fkt : function
function that shall be measured
Returns
-------
None
"""
def fkt_wrapper(*args, **kwargs):
t1 =... | 43fe9fa24fdd27f15e988f5997424dd91f7d92c9 | 4,062 |
def test_find_codon(find_codon):
"""
A function to test another function that looks for a codon within
a coding sequence.
"""
synapto_nuc = ("ATGGAGAACAACGAAGCCCCCTCCCCCTCGGGATCCAACAACAACGAGAACAACAATGCAGCCCAGAAGA"
"AGCTGCAGCAGACCCAAGCCAAGGTGGACGAGGTGGTCGGGATTATGCGTGTGAACGTGGAGAAGGTCCT"
"GGAG... | 1e8906441d7812fbaefd7688a1c02876210ba8b8 | 4,063 |
def compose_paths(path_0, path_1):
"""
The binary representation of a path is a 1 (which means "stop"), followed by the
path as binary digits, where 0 is "left" and 1 is "right".
Look at the diagram at the top for these examples.
Example: 9 = 0b1001, so right, left, left
Example: 10 = 0b1010, ... | cffb984c5bacf16691648e0910988495149087ad | 4,065 |
def group_masses(ip, dm: float = 0.25):
"""
Groups masses in an isotope pattern looking for differences in m/z greater than the specified delta.
expects
:param ip: a paired list of [[mz values],[intensity values]]
:param dm: Delta for looking +/- within
:return: blocks grouped by central mass
... | 918fc4f20fee7c2955218e3c435f9e672dc55f7d | 4,066 |
import os
def get_compliment(file_list, file):
"""Returns a file path from the provided list that has the same name as the
file passed as the second arugment.
:param file_list: A list of paths with the same filetype.
:type file_list: list
:param file: A single path with an opposite filetype.
... | 9841207dc2ead05a1fde42baeea72e05323fb6ea | 4,067 |
def load_string_list(file_path, is_utf8=False):
"""
Load string list from mitok file
"""
try:
with open(file_path, encoding='latin-1') as f:
if f is None:
return None
l = []
for item in f:
item = item.strip()
if ... | 600c2678fdcdf6d5fa4894dd406f74c1ae4e5a96 | 4,068 |
import math
def point_based_matching(point_pairs):
"""
This function is based on the paper "Robot Pose Estimation in Unknown Environments by Matching 2D Range Scans"
by F. Lu and E. Milios.
:param point_pairs: the matched point pairs [((x1, y1), (x1', y1')), ..., ((xi, yi), (xi', yi')), ...]
:ret... | 2d691bbf04d14e3e5b0f9273a7501d934bd0eef4 | 4,069 |
def bind_port(socket, ip, port):
""" Binds the specified ZMQ socket. If the port is zero, a random port is
chosen. Returns the port that was bound.
"""
connection = 'tcp://%s' % ip
if port <= 0:
port = socket.bind_to_random_port(connection)
else:
connection += ':%i' % port
... | 5613bae6726e2f006706b104463917e48d7ab7ca | 4,071 |
def update_target_graph(actor_tvars, target_tvars, tau):
""" Updates the variables of the target graph using the variable values from the actor, following the DDQN update
equation. """
op_holder = list()
# .assign() is performed on target graph variables with discounted actor graph variable values
f... | 15f0d192ff150c0a39495b0dec53f18a8ae01664 | 4,072 |
def strtime(millsec, form="%i:%02i:%06.3f"):
"""
Time formating function
Args:
millsec(int): Number of milliseconds to format
Returns:
(string)Formated string
"""
fc = form.count("%")
days, milliseconds = divmod(millsec, 86400000)
hours, milliseconds = divmod(millsec, 3... | 9a1cff92086491941d8b27857169bf7744da8324 | 4,073 |
import argparse
def parse_args():
"""Parse input arguments."""
parser = argparse.ArgumentParser(description='Run train or eval scripts for Gated2Depth')
parser.add_argument("--base_dir", help="Path to dataset", required=True)
parser.add_argument("--train_files_path", help="Path to file with train fi... | afb3f6d55b87c917225811f3716b9ecf1fcb494e | 4,074 |
def plugin_last():
"""This function should sort after other plug-in functions"""
return "last" | d2d6c00bc8d987363bd4db0013950d9b3f524c2f | 4,075 |
def extract_shebang_command(handle):
"""
Extract the shebang_ command line from an executable script.
:param handle: A file-like object (assumed to contain an executable).
:returns: The command in the shebang_ line (a string).
The seek position is expected to be at the start of the file and will b... | 27174f96f2da3167cf7a7e28c4a2f1cec72c773c | 4,076 |
import json
def clone_master_track(obj, stdata, stindex, stduration):
"""
ghetto-clone ('deep copy') an object using JSON
populate subtrack info from CUE sheet
"""
newsong = json.loads(json.dumps(obj))
newsong['subsong'] = {'index': stindex, 'start_time': stdata['index'][1][0], 'duration': std... | 6721a87abfc88d9dd75f597ff24caf5857be594a | 4,077 |
def create_graph(num_islands, bridge_config):
"""
Helper function to create graph using adjacency list implementation
"""
adjacency_list = [list() for _ in range(num_islands + 1)]
for config in bridge_config:
source = config[0]
destination = config[1]
cost = config[2]
... | b961f5ee2955f4b8de640152981a7cede8ca80b0 | 4,078 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.